DNA

UniversityAffiliation

The strandGTAACCGTATTGCAGCTATTAGCAGCCATGCATTGGCATAACGTCGATAATCGTCGGTACA is usedto produce mRNA sequence ofCAUUGGCAUAACGUCGAUAAUCGUCGGUACGUAACCGUAUUGCAGCUAUUAGCAGCCAUG. This isbecause C pairs up with G while T pairs up with A. Besides, adenosinein is taken for uradine in RNA. A gene needs a promoter so as tosend signals to the RNA polymerase. Such signals usually specifywhere the transcription of is to start. Various components haveto be coordinated to produce proteins. contains geneticinformation fundamental for the coding of proteins. However, molecules cannot pass through the nuclear membrane. Therefore, mRNAis fundamental in transferring the coding information from the inthe nucleus to the ribosomes in the cytoplasm. mRNA copies andtransfers protein coding in codon form. tRNA carries amino acids tothe ribosome for incorporation into polypeptide chains. The codons onmRNA are complementary to the anticodons on tRNA. The amino acidscarried by tRNA are unique to the anticodons (Anders &ampMigliorini, 2014). In this manner, the ribosomes can form all typesof body proteins.

A frame shiftmutation disrupts the sequence of amino acids. Consequently, theribosome misinterprets the cordon. If the ribosome starts encodingthe material at a different place than it was meant to, this willaffect the entire polypeptide chain. When the ribosome readsdifferent codons, an altered set of amino acids is formed. Since ashift mutation changes the sequence of amino acids, the resultingprotein would be dysfunctional. If a G were added after the thirdnucleotide, this would disrupt the entire sequence of amino acids.The fifteen nucleotides would be retained, albeit without thecytosine at the end (Beljanski, 2013). This would impact the functionof the protein in the cell since nucleotides code for differentproteins.

The three basesfound at the end of tRNA code for a particular amino acid. Therefore,insertion or deletion of three (or a multiple of three) base pairshas no effect on the original sequence (Beljanski, 2013). On theother hand, inserting a single nucleotide would have a deleteriouseffect since frame shift mutation will occur. In the latter case, thedeleterious effect would be more likely since the entire sequence ofamino acids would change.

References

Anders, H. &amp Migliorini, A. (2014). Innate and RNArecognition: Methods and protocols. New York, NY: Humana Press.

Beljanski, M. (2013). The regulation of replication andtranscription. New York, NY: Demos Medical Publishing.